Article Text
PDF
Abstract
Introduction Pancreatic and duodenal homeobox factor-1 (PDX-1) is an imperative gene for insulin secretion in maturity-onset diabetes of the young 4. PDX-1 gene polymorphism was associated with lower first-phase insulin secretion in a genome-wide association study of intravenous glucose tolerance test. It was not associated with type 2 diabetes risk and insulin secretion in a genome-wide oral glucose tolerance test study. However, there have been no reports of overt type 2 diabetes and insulin resistance evaluation using a glucose clamp. We investigated PDX-1 polymorphism, insulin secretion, and insulin resistance in overt type 2 diabetes.
Research design and methods We performed a meal tolerance test (MTT) and hyperinsulinemic–euglycemic clamping on 63 Japanese subjects, 30 with type 2 diabetes and 33 non-diabetic. We analyzed the rs1124607 PDX-1 gene polymorphism and defined A/C and C/C as the high-risk group and A/A as the low-risk group.
Results HOMA-beta (homeostatic model assessment beta-cell function) was significantly lower in the high-risk group than in the low-risk group for all subjects (72.9±54.2% vs 107.0±63.5%, p<0.05). Glucose levels and glucose area under the curve (AUC) were not significantly different between both the risk groups. The insulin levels at 60 and 120 min and the insulin AUC after MTT were remarkably lower in the high-risk group than those in the low-risk group for all subjects (AUC 75.7±36.7 vs 112.7±59.5, p<0.05). High-risk subjects with type 2 diabetes had significantly lower insulin levels at 30 and 60 min and insulin AUC than low-risk subjects. Non-diabetic high-risk subjects depicted significantly lower insulin levels at 120 and 180 min. There were negligible differences in insulin resistance between the risk groups.
Conclusions These results suggest that the PDX-1 genetic polymorphism is crucial for insulin secretion in Japanese patients with type 2 diabetes.
- insulin secretion
- insulin resistance
Data availability statement
Data are available on reasonable request.
This is an open access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited, appropriate credit is given, any changes made indicated, and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/.
Statistics from Altmetric.com
WHAT IS ALREADY KNOWN ON THIS TOPIC
PDX-1 gene polymorphism was associated with lower first-phase insulin secretion in a genome-wide association study of intravenous glucose tolerance tests but was not associated with type 2 diabetes risk and insulin secretion in a genome-wide oral glucose tolerance test study.
WHAT THIS STUDY ADDS
Insulin levels after meal tolerance test (MTT) were significantly lower in the high-risk group of PDX-1 polymorphism than those in the low-risk group in both type 2 diabetes and non-diabetic individuals, but there were no major differences in insulin resistance between both the risk groups.
HOW THIS STUDY MIGHT AFFECT RESEARCH, PRACTICE OR POLICY
If we could analyze the PDX-1 genetic polymorphism, we might estimate the low insulin secretion ability of patients with type 2 diabetes.
Introduction
The key pathophysiology of type 2 diabetes mellitus (T2DM) is enhanced insulin resistance and decreased insulin secretion.1 Pancreatic and duodenal homeobox factor-1 (PDX-1) is a gene associated with insulin secretion, mutations of which cause maturity-onset diabetes of the young (MODY) 4.2 A rare frameshift variant of PDX1, encoding p.Gly218Alafs*12, has been reported as a risk factor for T2DM.3 Genetic variation of PDX-1 was associated with higher fasting glucose and lower first-phase insulin secretion in a genome-wide association study (GWAS) of intravenous glucose tolerance tests (IVGTTs), but not with T2DM risk in a genome-wide oral glucose tolerance test (OGTT) study.4 They also noted that it was not associated with OGTT-based measures of insulin secretion in another study.5 The authors mentioned that OGTT is affected by incretins, but IVGTT remains unaffected. However, these studies were performed using IVGTT and OGTT, and there are few studies on overt diabetes conditions due to the risk of hyperglycemia. These studies are meta-analyses of GWAS, and there is no evidence that the PDX-1 gene affects T2DM risk even in a large case–control study.4 6 Therefore, clinical studies based on detailed physiological assessments are essential. In addition, the Japanese and East Asian populations with mild obesity depict low insulin secretion and resistance.7 GWAS studies have been conducted in European, American and South Asian populations but not in East Asians. Hence, a PDX-1 study on East Asian and Japanese population is required. Furthermore, no study has evaluated the association between the PDX-1 gene and insulin resistance using the glucose clamp method.
Considering this, we performed a meal tolerance test (MTT) and a glucose clamp test on overt type 2 diabetic and non-diabetic healthy volunteers. We demonstrated that PDX-1 gene polymorphism is associated with insulin secretion in the MTT assay.
Materials and methods
Subjects
A total of 65 subjects, 30 with T2DM and 35 without diabetes (non-diabetics), participated in this study at Tottori University Hospital between 2011 and 2021. T2DM was diagnosed using the WHO criteria.8 We recruited subjects aged between 20 and 80 years and patients with T2DM with glycated hemoglobin (HbA1c) 6.5%–9.0%, without diabetic medication. We excluded patients with cancer, pancreatitis, viral hepatitis, liver cirrhosis, renal failure, or those on diabetic medications. All participants belonged to Japanese ethnicity and were on diet therapy alone. This study had a cross-sectional design. A previous Japanese study reported that the rs1124607 PDX-1 polymorphism indicated an AA: AC: CC ratio of 2:1:0.13.9 We planned to include over 30 subjects each in T2DM group and non-diabetes group so that we could obtain 10 subjects each in AA and AC group. As PDX-1 polymorphism is not an established risk factor for T2DM, in this previous study, diabetes was diagnosed by HbA1c. OGTT and IVGTT were not conducted.
We excluded two subjects due to the inconvenience of data: one had negative results for the insulinogenic index, and the other had an unreliable PDX-1 genotype (online supplemental figure 1).
Supplemental material
This study was conducted as per the principles of the Declaration of Helsinki. It was approved by the Ethics Committee of the Faculty of Medicine of Tottori University (approval no: G161). Informed consent was obtained from all participants using a procedure approved by the ethics committee.
Meal tolerance test
We conducted an MTT assay using a test meal developed by the Japan Diabetes Society as reported previously.10 11 The participants visited our hospital after fasting overnight and consumed the test meal (460 kcal, 50% carbohydrate, 15% protein and 35% fat). Plasma glucose and serum insulin levels were measured at 0, 30, 60, 120, and 180 min after consumption of the test meal. Plasma glucose was estimated using the glucose oxidase method, and serum insulin levels were quantified using chemiluminescent immunoassays (human insulin chemiluminescent immunoassay kits; Kyowa Medix, Tokyo, Japan). We measured HbA1c using high-performance liquid chromatography. We converted HbA1c percentage values into the International Federation of Clinical Chemistry values (mmol/mol) employing the HbA1c converter from the National Institute of Diabetes and Digestive and Kidney Diseases.12
Insulin secretion index was calculated as follows:
Homeostasis model assessment of beta-cell function (HOMA-beta)13={20×[fasting plasma insulin (pmol/L)]}/{[fasting plasma glucose (mmol/L)]−3.5}.
Insulinogenic index14={[insulin (pmol/L) at 30 min]−[insulin (pmol/L) at 0 min]}/{[glucose (mmol/L) at 30 min]−[glucose (mmol/L) at 0 min]}.
Insulin resistance was calculated as follows:
Homeostatic model assessment of insulin resistance (HOMA-IR)13=[fasting plasma glucose (mmol/L)]×[fasting plasma insulin (pmol/L)]/135.
Insulin sensitivity index (ISI)15=10 000/√{ fasting plasma glucose (mmol/L)×fasting plasma insulin (pmol/L)]×[mean glucose×mean insulin during MTT]}.
Insulin secretion ability adjusted by insulin resistance was calculated as follows:
Disposition index16=Insulinogenic index/Insulin sensitivity index.
Hyperinsulinemic–euglycemic clamp
We conducted the glucose clamp test as previously reported.10 11 A hyperinsulinemic–euglycemic clamp was performed using an artificial endocrine pancreas (STG 55; Nikkiso, Shizuoka, Japan) to evaluate insulin sensitivity. We used the protocol involving primed constant infusion of insulin (100 mU/m2/min) and maintained the plasma glucose levels at 5.2 mmol/L (95 mg/dL). In previous studies, this method achieved a steady-state plasma insulin level of 1200 pmol/L (200 µU/L) in patients with T2DM.17 The steady-state glucose infusion rate (GIR) from 90 to 120 min was measured, and the mean GIR during this interval was defined as the glucose disposal rate (GDR), which is used as a marker for peripheral insulin sensitivity. We also calculated the M/I ratio as a measure of the quantity of glucose metabolized adjusted by the unit of plasma insulin concentration and defined the M value as the GDR and the I value as the steady-state insulin concentration.18
PDX-1 gene analysis
We analyzed the PDX-1 allele rs1124607, as previously reported in a large Japanese study.9 The context sequence was AGGGAGGGAAAGGAAACTGCACCCA [A/C] CCCAGCAGTGTCCGGCTGCCCTGGT, which was assessed using the PCR single-strand conformation polymorphism method after DNA sequencing as previously reported.11 We divided the patients into low-risk (A/A) and high-risk ((A/C) or (C/C)) groups, depending on the genotype.
Genomic DNA was obtained from peripheral blood leucocytes using proteinase K digestion and phenol/chloroform extraction. The PCR mixture contained genomic DNA as a template, primers, dNTPs, AmpliTaq Gold (PE Biosystems, Tokyo, Japan), and the supplemented buffer. The primer sequences were as follows: forward primer (PDX1-F): 5′-GGCTTCGGACACTACAGATC-3′, reverse G (name: PDX1-R): 5′-CCTTCCTCTTTACTCCTATC-3′. PCR was performed under the following conditions: denaturation for 5 min at 95°C, followed by amplification for 35 cycles of 1 min at 95°C, 1 min at 60°C, and 1 min at 72°C in a thermal cycler. The products were separated using a 2% agarose gel to confirm their size.
DNA sequencing
A direct sequencing reaction was performed using an ABI PRISM BigDye Terminator Cycle Sequencing Kit, and the sequencing samples were analyzed using an ABI PRISM 310 Genetic Analyzer (PE Biosystems). Sequencing data were evaluated using the ALF software package (Pharmacia, Tokyo, Japan) and GENETYXMAC software (Software Development, Tokyo, Japan).
Statistical analysis
Data are expressed as mean±SD. We assessed differences in the mean values of clinical parameters between PDX-1 high-risk and low-risk subjects using the Mann-Whitney U test. We employed a multivariable linear regression model to test the differences in insulin secretion due to difference in PDX-1 genotype by adjusting for age, sex, and body mass index (BMI). PRISM9 software (GraphPad Software, San Diego, California, USA) was used for all the analyses. We conducted a power analysis to compare the HOMA-beta between PDX-1 gene high- and low-risk groups using an EZR calculator.19 We conducted a power analysis of the statistical test used for comparing HOMA-beta between the high- and low-risk groups. The mean HOMA-beta values in the high-risk and low-risk groups were 72.9±54.2 and 107.0±63.1, respectively. Assuming that the difference in the means of HOMA-beta in all subjects was 37.7 and the SD was 29.9, the estimated power was 86%. If the difference in means of HOMA-beta in T2DM subjects was 34.1 and the SD was 8.9, the estimated power was >99%. Values of p<0.05 were significant.
Results
The characteristics of all participants are presented in table 1. Fifteen subjects had a high-risk AC genotype, 1 non-DM subject had a high-risk CC genotype, and 47 had a low-risk AA genotype. The high-risk group exhibited significantly lower HOMA-beta values than the low-risk group (p<0.05). However, differences in other parameters such as BMI, fasting glucose, HbA1c, HOMA-IR and GDR were insignificant.
Clinical data comparison between high-risk and low-risk subjects, classified based on PDX-1 genotype
The characteristics of T2DM subjects are represented in table 2. Among the T2DM subjects, 8 were in the high-risk group and 22 in the low-risk group. Patients in the high-risk group had significantly lower HOMA-beta than those in the low-risk group (p<0.05), but differences in BMI, fasting glucose, HbA1c, HOMA-IR, and GDR were insignificant. Furthermore, the high-risk group exhibited significantly higher low-density lipoprotein (LDL) cholesterol than the low-risk group (p<0.05). The insulinogenic index tended to be comparatively lower in the high-risk group than that in the low-risk group, but the difference was statistically insignificant.
Clinical data comparison of patients with high-risk and low-risk T2DM, classified based on PDX-1 genotype
The non-diabetes group had 8 high-risk and 25 low-risk subjects; there were negligible differences in clinical parameter values between the two risk groups (table 3).
Clinical data comparison between high-risk and low-risk non-diabetes subjects, classified based on PDX-1 genotype
Figure 1 depicts the glucose and insulin responses during the MTT assay. There were inconsequential differences in glucose levels between the high-risk and low-risk groups for all subjects, the T2DM group, and the non-diabetes group (figure 1A–C). The glucose area under the curve (AUC) also indicated negligible differences between both the risk groups for all subjects, the T2DM group, and the non-diabetes group (tables 1–3). All subjects in the high-risk group exhibited remarkably lower insulin levels at 60 and 120 min after the meal than those in the low-risk group (p<0.05) (figure 1D). Furthermore, the high-risk group had lower insulin AUC after the meal than the low-risk group (p<0.05) (table 1). Patients with T2DM with the high-risk genotype had significantly lower insulin levels at 30 and 60 min than those with the low-risk genotype (p<0.05) (figure 1E). The high-risk group of T2DM subjects also exhibited significantly lower insulin AUC after the meal than the low-risk group (p<0.05) (table 2). The non-diabetes subjects with high-risk genotype had significantly lower insulin levels at 120 and 180 min after the meal than those with low-risk genotype (p<0.05) (figure 1F). However, the insulin AUC in the non-diabetic subjects did not show a remarkable difference (table 3).
Glucose and insulin response during meal tolerance test (MTT). MTT results. Figure shows (A) the glucose levels of all subjects after the MTT, (B) glucose levels of patients with type 2 diabetes, (C) glucose levels of non-diabetes subjects, (D) insulin levels of all subjects, (E) insulin levels of patients with type 2 diabetes, and (F) insulin levels of non-diabetic subjects. Black circles represent the data for high-risk genotype subjects, and white squares indicate low-risk genotype subjects. *p<0.05.
Table 4 depicts the comparison of clinical parameters between T2DM and non-diabetes patients with the high-risk genotype. The disposition index of T2DM in the high-risk group was remarkably lower than the high-risk non-diabetes group (p<0.05).
Clinical data comparison between T2DM and non-diabetes subjects with high-risk PDX-1 genotype
We employed a multivariable linear regression model to test whether the differences in insulin secretion due to differences in PDX-1 genotype persisted after adjusting for age, sex, and BMI in all subjects. The PDX-1 genotype was shown to be a major risk factor for low insulin secretion, assessed as HOMA-beta, and insulin AUC even after adjusting for age, sex, and BMI. The standardized partial regression coefficient (95% CI) was 2.715 (−67.81 to −10.27, p<0.01) for HOMA-beta and 2.034 (−336.3 to −2.720, p<0.05) for insulin AUC (online supplemental table 1).
Supplemental material
Discussion
The subjects with the PDX-1 high-risk polymorphism demonstrated a lower insulin secretion ability, assessed as HOMA-beta, and lower insulin AUC during the MTT than those with the low-risk genotype in this study. The PDX-1 high-risk genotype was a significant risk factor for low insulin secretion, assessed as HOMA-beta, and insulin AUC, even when adjusted for age, sex, and BMI. Moreover, participants with T2DM with the high-risk genotype showed lower early phase insulin secretion at 30 and 60 min and lower insulin AUC than those with the low-risk genotype. However, there were insignificant differences in insulin resistance data between the two groups. These results suggest that PDX-1 genotype is a crucial determinant of postprandial insulin secretion rather than insulin resistance. Patients with T2DM with a high-risk genotype exhibited a remarkably lower disposition index than non-diabetic individuals with a high-risk genotype. These results indicate that PDX-1 genotype plays a vital role in early phase insulin secretion under diabetic conditions. The PDX-1 gene polymorphism was associated with higher fasting glucose and lower first-phase insulin secretion in a GWAS of IVGTT,4 but it was not associated with OGTT-based measures of insulin secretion in another study.5 Our study used a test meal comprised proteins and lipids and did not use the OGTT. Our findings are crucial for evaluating postprandial glucose and insulin levels in T2DM.
A recent animal model of MODY4 reported that Pdx1+/− mice showed glucose intolerance without progressing to diabetes. However, the additional deterioration of β-cell function by I kappa B kinase (IKK) / Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) inhibition enhanced transformation to rapidly progressing diabetes, characterized by hyperglycemia, low insulinemia, and decreased β-cell mass.20 Our study demonstrated that the PDX-1 high-risk polymorphism in T2DM patients resulted in lower early phase insulin secretion levels. A human study reported that there was a decreased PDX-1 expression in human islets of patients with T2DM compared with that in non-diabetic subjects, which was a result of DNA methylation due to hyperglycemia.21 These results imply that the PDX-1 polymorphism and glucose toxicity may reduce early phase insulin secretion. Another mouse study showed that the combination of PDX-1 and GLUT4 heterozygosity markedly prolonged glucose clearance and concluded that reduced PDX-1 expression impairs islet response to insulin resistance and worsens glucose homeostasis.22 Our study also revealed disposition index, which is the early-phase insulin secretion ability adjusted by insulin resistance, to be remarkably lower in the high-risk DM group than in the high-risk non-DM group. However, the insulinogenic index showed negligible differences. These results imply that insulin resistance and diabetic conditions might impair early phase insulin secretion. A recent article reported saturated fatty acid-induced PDX-1 mislocalization in the nucleus of islet beta-cells and beta-cell dysfunction.23 We found considerably higher LDL cholesterol levels in the high-risk T2DM group than those in the low-risk group. These results signify that lipotoxicity might be important for PDX1 and beta-cell function.
Our study has several limitations. The small number of participants indicates that our results need to be confirmed in a large sample size study. Glucose clamp test is a very complicated technique, and it is challenging to recruit patients with overt diabetes who are not under medication. We are continuing this study for 10 years and are currently conducting a substantial study and would like to publish the results in the future. We used the MTT assay to avoid the risk of hyperglycemia due to the use of OGTT. Although the insulinogenic index did not show significant differences, there were variations in test meal consumption and pure glucose load administration, which also affect glucose and insulin levels. Although we analyzed only PDX-1, the exon variant rs1799854 of ABCC8 showed a noteworthy association with T2DM in Japanese patients.9 Further studies are needed, including those on ABCC8 and other genes. We analyzed only rs1124607, while rs11619319 was analyzed in a previous study.4 5 We obtained a sizeable amount of Japanese PDX-1 variant data from one study, which evaluated rs1124607 and rs4430606.9 As we could obtain HapMap data for rs1124607, we analyzed rs1124607. We also evaluated rs9581943, which is reported to be a risk factor for T2DM in the Chinese Han population,24 but this polymorphism failed to show an association with insulin secretion (data not shown). Further studies are essential to evaluate other PDX-1 polymorphic lesions. Our study subjects were Japanese and East Asian populations with low insulin secretion ability and insulin resistance with mild obesity.7 25 26 Further studies on other ethnic populations are required. We evaluated insulin secretion ability as HOMA-beta, which is a measure of insulin secretion based on data from Caucasians. In addition, HOMA-β insulin secretion is generally considered to be decreased when it falls below 50%, and it might be insufficient to assess the decrease in insulin secretion in the high-risk group. However, insulin AUC was also significantly lower in the high-risk group, suggesting that the PDX-1 polymorphism is vital for insulin secretion. Despite these limitations, our study contributes to the daily clinical work.
In conclusion, PDX-1 is an imperative gene associated with insulin secretion in Japanese patients with T2DM.
Data availability statement
Data are available on reasonable request.
Ethics statements
Patient consent for publication
Ethics approval
This study involves human participants and was approved by the Ethics Committee of the Faculty of Medicine, Tottori University (approval no G161). Participants gave informed consent to participate in the study before taking part.
Acknowledgments
This study was performed at the Faculty of Medicine, Tottori University, Tottori, Japan. We would like to thank Editage (www.editage.com) for English language editing.
References
Supplementary materials
Supplementary Data
This web only file has been produced by the BMJ Publishing Group from an electronic file supplied by the author(s) and has not been edited for content.
Footnotes
Contributors TO participated in the design of the study and performed the statistical analysis. RN, YI, SK, MA, SE, NT, KM, KS, HO, KM, SI, and EU collected the data. MK, TI, S-iT, and KY conceived the study, participated in its design and coordination, and helped to draft the manuscript. TO is the guarantor of this work and takes responsibility for the integrity and accuracy of the data and its analyses. All authors read and approved the final manuscript.
Funding This work was supported by a JSPS KAKENHI Grant-in-Aid for Scientific Research (C) Grant Number 19K07913 (2019–2022), 16K08935 (2016–2018), and a JSPS KAKENHI Grant-in-Aid for Young Scientists (B) Grant Number 26870373 (2014–2015).
Competing interests None declared.
Provenance and peer review Not commissioned; externally peer reviewed.
Supplemental material This content has been supplied by the author(s). It has not been vetted by BMJ Publishing Group Limited (BMJ) and may not have been peer-reviewed. Any opinions or recommendations discussed are solely those of the author(s) and are not endorsed by BMJ. BMJ disclaims all liability and responsibility arising from any reliance placed on the content. Where the content includes any translated material, BMJ does not warrant the accuracy and reliability of the translations (including but not limited to local regulations, clinical guidelines, terminology, drug names and drug dosages), and is not responsible for any error and/or omissions arising from translation and adaptation or otherwise.