Table 1

Sequence of the primers used for the quantitative PCR experiments

Forward primerReverse primer
Mouse β-actinAGGTCATCACTATTGGCACACAGGATTCCATACCCAAGAAG
Mouse G6PCTCTGTCCCGGATCTACCTTGGTAGAATCCAAGCGCGAAAC
Mouse GCKGAGATGGATGTGGTGGCAATACCAGCTCCACATTCTGCAT
Mouse PCKGTGAGGAAGTTCGTGGAAGGTCTGCTCTTGGGTGATGATG
  • GCK, glucokinase; G6PC, glucose 6 phosphatase; PCK, phosphoenolpyruvate carboxykinase.